{"status":"ok","message-type":"work","message-version":"1.0.0","message":{"indexed":{"date-parts":[[2026,10,6]],"date-time":"2026-10-06T15:26:03Z","timestamp":1791300363111,"version":"4.1.0"},"reference-count":28,"publisher":"American Association for the Advancement of Science (AAAS)","issue":"5537","content-domain":{"domain":[],"crossmark-restriction":false},"short-container-title":["Science"],"published-print":{"date-parts":[[2001,9,14]]},"abstract":"<jats:p>\n            Transcription factor TFIID, composed of TBP and TAF\n            <jats:sub>II<\/jats:sub>\n            subunits, is a central component of the RNA polymerase II machinery. Here, we report that the tissue-selective TAF\n            <jats:sub>II<\/jats:sub>\n            105 subunit of TFIID is essential for proper development and function of the mouse ovary. Female mice lacking TAF\n            <jats:sub>II<\/jats:sub>\n            105 are viable but infertile because of a defect in folliculogenesis correlating with restricted expression of TAF\n            <jats:sub>II<\/jats:sub>\n            105 in the granulosa cells of the ovarian follicle. Gene expression profiling has uncovered a defective inhibin-activin signaling pathway in TAF\n            <jats:sub>II<\/jats:sub>\n            105-deficient ovaries. Together, these studies suggest that TAF\n            <jats:sub>II<\/jats:sub>\n            105 mediates the transcription of a subset of genes required for proper folliculogenesis in the ovary and establishes TAF\n            <jats:sub>II<\/jats:sub>\n            105 as a cell type\u2013specific component of the mammalian transcriptional machinery.\n          <\/jats:p>","DOI":"10.1126\/science.1061935","type":"journal-article","created":{"date-parts":[[2002,7,27]],"date-time":"2002-07-27T09:52:08Z","timestamp":1027763528000},"page":"2084-2087","source":"Crossref","is-referenced-by-count":167,"title":["Requirement of Tissue-Selective TBP-Associated Factor TAF\n            <sub>II<\/sub>\n            105 in Ovarian Development"],"prefix":"10.1126","volume":"293","author":[{"given":"Richard N.","family":"Freiman","sequence":"first","affiliation":[{"name":"Department of Molecular and Cell Biology,"}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Shane R.","family":"Albright","sequence":"additional","affiliation":[{"name":"Department of Molecular and Cell Biology,"},{"name":"Howard Hughes Medical Institute, University of California at Berkeley, Berkeley, CA 94720\u20133204, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Shuang","family":"Zheng","sequence":"additional","affiliation":[{"name":"Department of Molecular and Cell Biology,"},{"name":"Howard Hughes Medical Institute, University of California at Berkeley, Berkeley, CA 94720\u20133204, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"William C.","family":"Sha","sequence":"additional","affiliation":[{"name":"Department of Molecular and Cell Biology,"}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Robert E.","family":"Hammer","sequence":"additional","affiliation":[{"name":"Howard Hughes Medical Institute, University of California at Berkeley, Berkeley, CA 94720\u20133204, USA."},{"name":"Department of Biochemistry and the Green Center for Reproductive Biology Sciences, University of Texas Southwestern Medical Center at Dallas, Dallas, TX 75390, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Robert","family":"Tjian","sequence":"additional","affiliation":[{"name":"Department of Molecular and Cell Biology,"},{"name":"Howard Hughes Medical Institute, University of California at Berkeley, Berkeley, CA 94720\u20133204, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]}],"member":"221","reference":[{"key":"e_1_3_1_2_2","doi-asserted-by":"publisher","DOI":"10.1016\/0092-8674(93)90386-5"},{"key":"e_1_3_1_3_2","doi-asserted-by":"publisher","DOI":"10.1126\/science.8178153"},{"key":"e_1_3_1_4_2","doi-asserted-by":"publisher","DOI":"10.1016\/S0092-8674(00)81330-6"},{"key":"e_1_3_1_5_2","doi-asserted-by":"publisher","DOI":"10.1073\/pnas.93.24.13611"},{"key":"e_1_3_1_6_2","doi-asserted-by":"publisher","DOI":"10.1101\/gad.11.11.1381"},{"key":"e_1_3_1_7_2","doi-asserted-by":"publisher","DOI":"10.1016\/0092-8674(93)90664-C"},{"key":"e_1_3_1_8_2","doi-asserted-by":"publisher","DOI":"10.1074\/jbc.275.18.13895"},{"key":"e_1_3_1_9_2","doi-asserted-by":"publisher","DOI":"10.1093\/emboj\/17.17.5161"},{"key":"e_1_3_1_10_2","doi-asserted-by":"publisher","DOI":"10.1074\/jbc.275.22.16459"},{"key":"e_1_3_1_11_2","unstructured":"Total protein extracts were prepared from mouse ovaries of 8-week-old mice that were hormonally synchronized for 48 hours by injection of 7 IU of PMS-G. Ovaries were harvested washed in phosphate-buffered saline dounced in extraction buffer [200 mM KCl 100 mM tris (pH 7.9) 0.2 mM EDTA 10% glycerol and 0.1% NP-40] and incubated for 1 hour on ice. Either 20 \u03bcl of anti-Myc negative control or 20 \u03bcl of anti-TBP\/protein A\u2013Sepharose CL-4B (Amersham Pharmacia) beads were incubated with 0.3 ml of ovary extract for 4 hours at 4\u00b0C. Immune complexes were washed twice in 0.2 M KCL twice in 0.5 M KCl and then twice in 0.2 M KCl on ice. Beads were boiled in sample buffer and separated on either a 7.5 or 10% SDS\u2013polyacrylamide gel electrophoresis (SDS-PAGE) gel. Western blot analysis was carried out with rabbit polyclonal antisera diluted to 1:5000 for anti-TAF II 105 or to 1:2500 for anti-TAF II 250 and TBP. The secondary antibody to immunoglobulin G\u2013horseradish peroxidase (Pierce Rockford IL) was diluted to 1:5000 and proteins were visualized with enhanced chemiluminesence (Amersham Pharmacia). For the protein samples in Fig. 2D splenocytes derived from mice of each genotype were activated with lipopolysaccharide (LPS) lysed in sample buffer and separated by a 6% SDS-PAGE gel."},{"key":"e_1_3_1_12_2","unstructured":"Overlapping phage clones containing a portion of the TAF II 105 gene were isolated from a mouse 129Sv genomic library and subcloned to generate pBT3. Not I\u2013linearized pBT3 was electroporated into R1 ES cells. The targeting event removed half of exon h located in the 3\u2032 end of the TAF II 105 gene replacing it with a neo cassette in the reverse orientation. Genomic DNA was isolated from neomycin-resistant ES clones digested with Bam HI and analyzed by Southern blot analysis against a 32 P-labeled genomic fragment. Targeting efficiency was about 1.6%. Heterozygous ES cells were injected into blastocysts to establish founder chimeric mice and chimeric mice that transmitted to the germ line were bred to homozygosity. To genotype mice tail genomic DNA was analyzed in a single PCR reaction containing three primers (105G2 AACATGTAATGGATTTTCT; 105G4 GGTCTGTATTTCCTTAATGG; and Neo2 CTAATTCATCAGAAGCTGAC) which amplifies a 200\u2013base pair (bp) fragment and a 150-bp fragment from the wild-type and mutant TAF II 105 alleles respectively. Western blot analysis was used to confirm the loss of full-length TAF II 105 and the absence of COOH-terminally truncated forms of TAF II 105. Heterozygous TAF II 105 mice were back-crossed to the inbred C57BL\/6J strain (Jackson Laboratories West Grove PA)."},{"key":"e_1_3_1_13_2","unstructured":"R. N. Freiman R. Tjian unpublished data."},{"key":"e_1_3_1_14_2","doi-asserted-by":"publisher","DOI":"10.1073\/pnas.82.13.4438"},{"key":"e_1_3_1_14_3","unstructured":". TAF II 105 \u2013\/\u2013 females were bred with vasectomized males and the presence of a copulatory plug indicated a successful mating. On day 0.5 postcoitum WT B6SJL F 2 hybrid two-cell eggs were transferred into one oviduct of each \u2013\/\u2013 pseudopregnant female as previously described. Superovulation was induced by a standard hormone regimen and ovulated eggs were collected 13 hours after injection of human chorionic gonadotropin as previously described."},{"key":"e_1_3_1_15_2","unstructured":"Supplementary Web material is available on Science Online at www.sciencemag.org\/cgi\/content\/full\/293\/5537\/2084\/DC1."},{"key":"e_1_3_1_16_2","doi-asserted-by":"publisher","DOI":"10.1530\/ror.0.0030183"},{"key":"e_1_3_1_17_2","doi-asserted-by":"publisher","DOI":"10.1006\/frne.1996.0013"},{"key":"e_1_3_1_18_2","doi-asserted-by":"publisher","DOI":"10.1038\/384470a0"},{"key":"e_1_3_1_19_2","doi-asserted-by":"publisher","DOI":"10.1101\/sqb.1998.63.141"},{"key":"e_1_3_1_20_2","doi-asserted-by":"publisher","DOI":"10.1101\/gad.869101"},{"key":"e_1_3_1_21_2","doi-asserted-by":"publisher","DOI":"10.1016\/S1097-2765(00)00068-X"},{"key":"e_1_3_1_22_2","doi-asserted-by":"publisher","DOI":"10.1016\/S1097-2765(00)00069-1"},{"key":"e_1_3_1_23_2","doi-asserted-by":"publisher","DOI":"10.1126\/science.290.5500.2312"},{"key":"e_1_3_1_24_2","doi-asserted-by":"publisher","DOI":"10.1016\/S1097-2765(01)00198-8"},{"key":"e_1_3_1_25_2","doi-asserted-by":"publisher","DOI":"10.1126\/science.1059188"},{"key":"e_1_3_1_26_2","unstructured":"Antisense riboprobes labeled with 32 P\u2013uridine 5\u2032-triphosphate were synthesized with Maxiscript (Ambion Austin TX). Plasmid pAA12 was linearized with Acc65I and transcribed with T7 RNA polymerase to synthesize an antisense TAF II 105 probe; plasmid pZ33 was linearized with Pst I and transcribed with T3 RNA polymerase to synthesize an antisense TAF II 130 probe. Hybridizations were carried out with RPA III (Ambion). To detect TAF II 105 and TAF II 130 levels we used 30 \u03bcg of total RNA (Ambion) and to detect 18 S rRNA levels we used 1 \u03bcg of total RNA. For assays in Fig. 4 3 \u03bcg of total RNA derived from +\/\u2013 and \u2013\/\u2013 ovaries was used."},{"key":"e_1_3_1_27_2","unstructured":"Ovaries from 6-week-old females were removed from hormonally primed mice dissected weighed and fixed in 10% neutral buffered formalin. Specimens were embedded in paraffin sectioned at 5 \u03bcm stained with hematoxylin and eosin and examined and photographed at the identical magnification with a Leica DMR microscope equipped with a MetaMorph Imaging System. For in situ hybridizations ovaries were dissected from HET and KO females and fixed in a 6:3:1 cocktail of ethanol formaldehyde (37%) and acetic acid overnight at 4\u00b0C. Ovaries were dehydrated in an ethanol series and Histoclear (National Diagnostics Atlanta GA) and then embedded in paraffin. Sections of 14 \u03bcm were prepared and probed with digoxygenin (DIG)\u2013labeled antisense RNA probes (Roche). An alkaline phosphatase-conjugated antibody to DIG (Roche) was used at a 1:2000 dilution to detect specific RNAs with the substrates NBT and BCIP (Gibco-BRL) and RNAs were visualized by the formation of a blue\/purple precipitate."},{"key":"e_1_3_1_28_2","unstructured":"We thank M. Haggart for technical assistance; L. Chu for contributions to this project; D. Bhattacharya and L. Liang for advice with the immunology assays; O. Kelly B. Martin and M. Dionne for instruction with in situ hybridizations; N. Hernandez for providing the anti-TBP; A. Ladurner for providing control and TAF II 250 antibodies; R. Henry for advice with immunoprecipitations; D. Schichnes and S. Ruzin of the CNR biological imaging facility; A. Winoto for RI ES cells; K. Thomas for a 129Sv genomic library; W. Skarnes for mouse blastocyst injections; R. Harland A. Hochheimer M. Holmes C. Inouye Y. Isogai B. Lemon and M. Levine for comments; and J. Lim for preparation of the manuscript. R.N.F. is a fellow of the Leukemia and Lymphoma Society. Supported in part by a grant from NIH to R.T."}],"container-title":["Science"],"original-title":[],"language":"en","link":[{"URL":"https:\/\/www.science.org\/doi\/pdf\/10.1126\/science.1061935","content-type":"unspecified","content-version":"vor","intended-application":"similarity-checking"}],"deposited":{"date-parts":[[2024,1,9]],"date-time":"2024-01-09T22:16:29Z","timestamp":1704838589000},"score":1,"resource":{"primary":{"URL":"https:\/\/www.science.org\/doi\/10.1126\/science.1061935"}},"subtitle":[],"short-title":[],"issued":{"date-parts":[[2001,9,14]]},"references-count":28,"journal-issue":{"issue":"5537","published-print":{"date-parts":[[2001,9,14]]}},"alternative-id":["10.1126\/science.1061935"],"URL":"https:\/\/doi.org\/10.1126\/science.1061935","relation":{},"ISSN":["0036-8075","1095-9203"],"issn-type":[{"value":"0036-8075","type":"print"},{"value":"1095-9203","type":"electronic"}],"subject":[],"published":{"date-parts":[[2001,9,14]]}}}