{"status":"ok","message-type":"work","message-version":"1.0.0","message":{"indexed":{"date-parts":[[2026,9,30]],"date-time":"2026-09-30T06:31:54Z","timestamp":1790749914490,"version":"4.1.0"},"reference-count":75,"publisher":"American Association for the Advancement of Science (AAAS)","issue":"5328","content-domain":{"domain":[],"crossmark-restriction":false},"short-container-title":["Science"],"published-print":{"date-parts":[[1997,8,15]]},"abstract":"<jats:p>\n            The critical role of chemokine receptors (CCR5 and CXCR4) in human immunodeficiency virus\u2013type 1 (HIV-1) infection and pathogenesis prompted a search for polymorphisms in other chemokine receptor genes that mediate HIV-1 disease progression. A mutation (\n            <jats:italic>CCR2-64I<\/jats:italic>\n            ) within the first transmembrane region of the\n            <jats:italic>CCR2<\/jats:italic>\n            chemokine and HIV-1 receptor gene is described that occurred at an allele frequency of 10 to 15 percent among Caucasians and African Americans. Genetic association analysis of five acquired immunodeficiency syndrome (AIDS) cohorts (3003 patients) revealed that although\n            <jats:italic>CCR2-64I<\/jats:italic>\n            exerts no influence on the incidence of HIV-1 infection, HIV-1\u2013infected individuals carrying the\n            <jats:italic>CCR2<\/jats:italic>\n            -\n            <jats:italic>64I<\/jats:italic>\n            allele progressed to AIDS 2 to 4 years later than individuals homozygous for the common allele. Because\n            <jats:italic>CCR2-64I<\/jats:italic>\n            occurs invariably on a\n            <jats:italic>CCR5-+<\/jats:italic>\n            \u2013bearing chromosomal haplotype, the independent effects of\n            <jats:italic>CCR5-\u039432<\/jats:italic>\n            (which also delays AIDS onset) and\n            <jats:italic>CCR2-64I<\/jats:italic>\n            were determined. An estimated 38 to 45 percent of AIDS patients whose disease progresses rapidly (less than 3 years until onset of AIDS symptoms after HIV-1 exposure) can be attributed to their\n            <jats:italic>CCR2-+\/+<\/jats:italic>\n            or\n            <jats:italic>CCR5-+\/+<\/jats:italic>\n            genotype, whereas the survival of 28 to 29 percent of long-term survivors, who avoid AIDS for 16 years or more, can be explained by a mutant genotype for\n            <jats:italic>CCR2<\/jats:italic>\n            or\n            <jats:italic>CCR5.<\/jats:italic>\n          <\/jats:p>","DOI":"10.1126\/science.277.5328.959","type":"journal-article","created":{"date-parts":[[2002,7,27]],"date-time":"2002-07-27T09:44:47Z","timestamp":1027763087000},"page":"959-965","source":"Crossref","is-referenced-by-count":659,"title":["Contrasting Genetic Influence of\n            <i>CCR2<\/i>\n            and\n            <i>CCR5<\/i>\n            Variants on HIV-1 Infection and Disease Progression"],"prefix":"10.1126","volume":"277","author":[{"given":"Michael W.","family":"Smith","sequence":"first","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Michael","family":"Dean","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Mary","family":"Carrington","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Cheryl","family":"Winkler","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Gavin A.","family":"Huttley","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Deborah A.","family":"Lomb","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"James J.","family":"Goedert","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Thomas R.","family":"O'Brien","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Lisa P.","family":"Jacobson","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Richard","family":"Kaslow","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Susan","family":"Buchbinder","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Eric","family":"Vittinghoff","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"David","family":"Vlahov","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Keith","family":"Hoots","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Margaret W.","family":"Hilgartner","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"name":"Hemophilia Growth and Development Study (HGDS)","sequence":"additional","affiliation":[],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia","family":"Study","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]},{"given":"Stephen J.","family":"O'Brien","sequence":"additional","affiliation":[{"name":"M. W. Smith, M. Carrington, C. Winkler, D. A. Lomb, Science Applications International Corp. Frederick, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"M. Dean, G. A. Huttley, S. J. O'Brien, Laboratory of Genomic Diversity, National Cancer Institute, Frederick, MD 21702\u20131201, USA."},{"name":"J. J. Goedert and T. R. O'Brien, Viral Epidemiology Branch, National Cancer Institute\u2013Executive Plaza North, 6130 Executive Boulevard, Bethesda, MD 20892, USA."},{"name":"L. P. Jacobson, Department of Epidemiology, The Johns Hopkins University School of Hygiene and Public Health, Room E-7008, 615 North Wolfe Street, Baltimore, MD 21205\u20131999, USA."},{"name":"R. Kaslow, Department of Epidemiology, University of Alabama at Birmingham, 720 South 20th Street, Tidwell Hall 212C, Birmingham, AL 35294, USA."}],"role":[{"vocabulary":"crossref","role":"author"}]}],"member":"221","reference":[{"key":"e_1_3_1_2_2","doi-asserted-by":"crossref","first-page":"529","DOI":"10.1038\/384529a0","volume":"384","author":"Fauci A. S.","year":"1996","unstructured":"Fauci A. S., Nature 384, 529 (1996);","journal-title":"Nature"},{"key":"e_1_3_1_2_3","doi-asserted-by":"crossref","first-page":"1885","DOI":"10.1126\/science.272.5270.1885","volume":"272","author":"Weiss R. A.","year":"1996","unstructured":"Weiss R. A., Science 272, 1885 (1996).","journal-title":"Science"},{"key":"e_1_3_1_3_2","unstructured":"M. P. D'Souza and"},{"key":"e_1_3_1_3_3","doi-asserted-by":"publisher","DOI":"10.1038\/nm1296-1293"},{"key":"e_1_3_1_4_2","doi-asserted-by":"crossref","first-page":"1051","DOI":"10.1016\/S0960-9822(02)70661-1","volume":"6","author":"Wilkinson D.","year":"1996","unstructured":"Wilkinson D., Curr. Biol. 6, 1051 (1996).","journal-title":"Curr. Biol."},{"key":"e_1_3_1_5_2","doi-asserted-by":"crossref","first-page":"1615","DOI":"10.1073\/pnas.94.5.1615","volume":"94","author":"Unutmaz D.","year":"1997","unstructured":"Unutmaz D., Littman D. R., Proc. Natl. Acad. Sci. U.S.A. 94, 1615 (1997).","journal-title":"Proc. Natl. Acad. Sci. U.S.A."},{"key":"e_1_3_1_6_2","doi-asserted-by":"publisher","DOI":"10.1126\/science.275.5304.1261"},{"key":"e_1_3_1_7_2","first-page":"276","volume":"276","author":"Simmons G.","year":"1997","unstructured":"Simmons G., et al., ibid. 276, 276 (1997).","journal-title":"ibid."},{"key":"e_1_3_1_8_2","doi-asserted-by":"crossref","unstructured":"F. Cocchi et al. ibid. 270 1811 (1995);","DOI":"10.1126\/science.270.5243.1811"},{"key":"e_1_3_1_8_3","doi-asserted-by":"publisher","DOI":"10.1038\/378563a0"},{"key":"e_1_3_1_9_2","doi-asserted-by":"publisher","DOI":"10.1126\/science.272.5263.872"},{"key":"e_1_3_1_10_2","unstructured":"G. Alkhatib et al. ibid. p. 1955."},{"key":"e_1_3_1_11_2","doi-asserted-by":"publisher","DOI":"10.1038\/381661a0"},{"key":"e_1_3_1_12_2","unstructured":"T. Dragic et al. ibid. p. 667."},{"key":"e_1_3_1_13_2","doi-asserted-by":"publisher","DOI":"10.1016\/S0092-8674(00)81313-6"},{"key":"e_1_3_1_14_2","unstructured":"B. J. Doranz et al. ibid. p. 1149."},{"key":"e_1_3_1_15_2","unstructured":"J. M. R. Frade et al. J. Clin. Invest. In press."},{"key":"e_1_3_1_16_2","doi-asserted-by":"crossref","first-page":"4400","DOI":"10.1128\/jvi.68.7.4400-4408.1994","volume":"68","author":"Conner R. I.","year":"1993","unstructured":"Conner R. I., et al., J. Virol. 68, 4400 (1993);","journal-title":"J. Virol."},{"key":"e_1_3_1_16_3","doi-asserted-by":"crossref","first-page":"427","DOI":"10.1093\/infdis\/165.3.427","volume":"165","author":"Raas M. T. L.","year":"1992","unstructured":"Raas M. T. L., et al., J. Infect. Dis. 165, 427 (1992);","journal-title":"J. Infect. Dis."},{"key":"e_1_3_1_16_4","doi-asserted-by":"crossref","first-page":"1354","DOI":"10.1128\/jvi.66.3.1354-1360.1992","volume":"66","author":"Schuitemaker H.","year":"1992","unstructured":"Schuitemaker H., et al., J. Virol. 66, 1354 (1992);","journal-title":"J. Virol."},{"key":"e_1_3_1_16_5","doi-asserted-by":"crossref","first-page":"1179","DOI":"10.1126\/science.8356453","volume":"261","author":"Zhao T.","year":"1993","unstructured":"Zhao T., et al., Science 261, 1179 (1993);","journal-title":"Science"},{"key":"e_1_3_1_16_6","doi-asserted-by":"crossref","first-page":"768","DOI":"10.1038\/383768a0","volume":"383","author":"Zhang L.","year":"1996","unstructured":"Zhang L., et al., Nature 383, 768 (1996);","journal-title":"Nature"},{"key":"e_1_3_1_16_7","first-page":"496","volume":"385","author":"Dittmar M. T.","year":"1997","unstructured":"Dittmar M. T., et al., ibid. 385, 496 (1997);","journal-title":"ibid."},{"key":"e_1_3_1_16_8","doi-asserted-by":"crossref","first-page":"349","DOI":"10.1093\/infdis\/173.2.349","volume":"173","author":"Koot M.","year":"1996","unstructured":"Koot M., et al., J. Infect. Dis. 173, 349 (1996).","journal-title":"J. Infect. Dis."},{"key":"e_1_3_1_17_2","doi-asserted-by":"crossref","first-page":"7515","DOI":"10.1128\/jvi.66.12.7517-7521.1992","volume":"66","author":"Collman R.","year":"1992","unstructured":"Collman R., et al., J. Virol. 66, 7515 (1992);","journal-title":"J. Virol."},{"key":"e_1_3_1_17_3","first-page":"4453","volume":"69","author":"Shibata R.","year":"1995","unstructured":"Shibata R., et al., ibid. 69, 4453 (1995).","journal-title":"ibid."},{"key":"e_1_3_1_18_2","doi-asserted-by":"publisher","DOI":"10.1016\/S0092-8674(00)80110-5"},{"key":"e_1_3_1_19_2","doi-asserted-by":"publisher","DOI":"10.1038\/382722a0"},{"key":"e_1_3_1_20_2","doi-asserted-by":"crossref","unstructured":"M. Dean et al. Science 273 1856 (1996).","DOI":"10.1126\/science.273.5283.1856"},{"key":"e_1_3_1_21_2","doi-asserted-by":"crossref","first-page":"412","DOI":"10.1038\/nm0496-412","volume":"2","author":"Paxton W. A.","year":"1996","unstructured":"Paxton W. A., et al., Nature Med. 2, 412 (1996);","journal-title":"Nature Med."},{"key":"e_1_3_1_21_3","doi-asserted-by":"crossref","first-page":"102","DOI":"10.1097\/00002030-199601000-00016","volume":"10","author":"Detels R.","year":"1996","unstructured":"Detels R., et al., AIDS 10, 102 (1996).","journal-title":"AIDS"},{"key":"e_1_3_1_22_2","doi-asserted-by":"publisher","DOI":"10.1038\/nm1196-1240"},{"key":"e_1_3_1_23_2","first-page":"338","volume":"3","author":"Michael N. L.","year":"1997","unstructured":"Michael N. L., et al., ibid. 3, 338 (1997);","journal-title":"ibid."},{"key":"e_1_3_1_23_3","doi-asserted-by":"publisher","DOI":"10.1007\/BF03401665"},{"key":"e_1_3_1_24_2","doi-asserted-by":"crossref","first-page":"252","DOI":"10.1038\/nm0397-252","volume":"3","author":"Biti R.","year":"1997","unstructured":"Biti R., et al., Nature Med. 3, 252 (1997);","journal-title":"Nature Med."},{"key":"e_1_3_1_24_3","doi-asserted-by":"crossref","unstructured":"; T. R. O\u2032Brien et al. Lancet 349 1219 (1997); I. Theodorou et al. ibid. p. 1219.","DOI":"10.1016\/S0140-6736(05)62411-7"},{"key":"e_1_3_1_25_2","doi-asserted-by":"crossref","first-page":"405","DOI":"10.1038\/nm0496-405","volume":"2","author":"Kaslow R. A.","year":"1996","unstructured":"Kaslow R. A., et al., Nature Med. 2, 405 (1996).","journal-title":"Nature Med."},{"key":"e_1_3_1_26_2","doi-asserted-by":"publisher","DOI":"10.1126\/science.271.5247.324"},{"key":"e_1_3_1_27_2","doi-asserted-by":"crossref","first-page":"102","DOI":"10.1097\/00002030-199601000-00016","volume":"10","author":"Detels R.","year":"1996","unstructured":"Detels R., et al., AIDS 10, 102 (1996).","journal-title":"AIDS"},{"key":"e_1_3_1_28_2","first-page":"275","volume":"9","author":"Kroner B.","year":"1995","unstructured":"Kroner B., ibid. 9, 275 (1995).","journal-title":"ibid."},{"key":"e_1_3_1_29_2","doi-asserted-by":"publisher","DOI":"10.1126\/science.274.5294.1924"},{"key":"e_1_3_1_30_2","doi-asserted-by":"crossref","first-page":"147","DOI":"10.1002\/jlb.60.1.147","volume":"60","author":"Combadiere C.","year":"1996","unstructured":"Combadiere C., Ahuja S. K., Tiffany H. L., Murphy P. M., J. Leukocyte Biol. 60, 147 (1996).","journal-title":"J. Leukocyte Biol."},{"key":"e_1_3_1_31_2","doi-asserted-by":"crossref","first-page":"3362","DOI":"10.1021\/bi952950g","volume":"35","author":"Samson M.","year":"1996","unstructured":"Samson M., Labbe O., Mollereau C., Vassart G., Parmentier M., Biochemistry 35, 3362 (1996).","journal-title":"Biochemistry"},{"key":"e_1_3_1_32_2","unstructured":"The coding region of the CCR2 gene was amplified with primers CCR2F3: 5\u2032 ATGCT GTCCA CATCT CGTTC and CCR2R3: 5\u2032 CCCAA AGACC CACTC ATTTG (1 to 327 bp); CCR2F4: 5\u2032 ATTAC TCTCC CATTG TGGGC and CCR2R4: 5\u2032 GGAAA TTATT CCATC CTCGTG (277 to 604 bp); CCR2F1: 5\u2032 TTCTG TTTAT GTCTG TGGCC and CCR2R6: 5\u2032 GATTG ATGCA GCAGT GAGTC (555 to 904 bp); and CCR2F5: 5\u2032 CCAAG CCACG CAGGT GACAG and CCR2R5: 5\u2032 TTATA AACCA GCCGA GACTT (852 to 1083 bp). The products were resolved on 6% acrylamide gels (37.5:1 acrylamide:bis-acrylamide) containing 10% glycerol at room temperature. The entire CCR2 coding region was examined by SSCP in 127 individuals. One common synonymous nucleotide substitution was discovered (N260N; f = 0.46) and three additional variants ( CCR2 : V52V P47L and S87A) were found in fewer than 1% of chromosomes. CCR2-64I homozygotes (one Caucasian and one African American) were sequenced through the entire coding region of CCR2 (including the CCR2A exon) and CCR5 as well as 500 bp of the upstream region of both genes. No nucleotide alterations were identified. More than 100 individuals have been screened by SSCP across the CCR5 gene. A total of 16 additional variants in the coding region have been identified (M. Carrington et al. in preparation). All of these variants are rare (\u22644%) and none is found exclusively on the CCR2-64I haplotype."},{"key":"e_1_3_1_33_2","unstructured":"Genotypes were determined by SSCP and with a PCR-RFLP assay using a Bsa BI site introduced into the PCR primer next to the C-T transition that encodes the CCR2-64I polymorphism. Amplification with the primers CKR2_1A: 5\u2032TTGTGGGCAACATGaTGG which has a cytosine substituted with an adenine (in lower case) and CKR2_1Z: 5\u2032GAGCCCACAATGGGAGAGTA generated a 128-bp product. Digestion with Bsa BI yields 110- and 18-bp fragments when an isoleucine was present instead of valine at position 64 in CCR2. These products were genotyped on 4% AMRESCO 3:1 biotechnology-grade agarose TBE gels."},{"key":"e_1_3_1_34_2","unstructured":"The cohorts and date of first enrollments were: the AIDS Link to the Intravenous Experience (ALIVE-1988) (34) Human Growth and Development (HGDS-1989) (35) Multicenter AIDS Cohort Study (MACS-1984) (36) Multicenter Hemophiliac Cohort Study (MHCS-1985) (37) and San Francisco City Clinic Study (SFCC-1978) (38). Patient genotypes were determined from DNA extracted from immortal lymphoblastoid B-cell lines established for each patient (19). The HGDS cohort did not include seroconvertor patients."},{"key":"e_1_3_1_35_2","unstructured":"D. Vlahov et al. NIDA Research Monograph Series 103 (Public Health Service Alcohol and Drug Abuse Administration Washington DC 1991)."},{"key":"e_1_3_1_36_2","doi-asserted-by":"publisher","DOI":"10.1097\/00043426-199305000-00009"},{"key":"e_1_3_1_37_2","doi-asserted-by":"crossref","first-page":"310","DOI":"10.1093\/aje\/126.2.310","volume":"126","author":"Kaslow R.","year":"1987","unstructured":"Kaslow R., et al., Am. J. Epidemiol. 126, 310 (1987);","journal-title":"Am. J. Epidemiol."},{"key":"e_1_3_1_37_3","first-page":"490","volume":"5","author":"Phair J.","year":"1992","unstructured":"Phair J., et al., J. Acquired Immune Defic. Syndr. 5, 490 (1992);","journal-title":"J. Acquired Immune Defic. Syndr."},{"key":"e_1_3_1_37_4","unstructured":"; The Multicenter AIDS Cohort Study (with principal investigators for each center) includes: The Johns Hopkins School of Public Health (Alfred Saah Alvaro Munoz Joseph Margolick); Northwestern University Medical School (John Phair); University of California Los Angeles (Roger Detels Janis V. Giorgi); and University of Pittsburgh (Charles Rinaldo). The study was funded by the National Institute of Allergy and Infectious Diseases cooperative agreements UO1-AI-35042 5-MO1-RR-00722(GCRC) UO1-AI-35043 UO1-AI-37984 UO1-AI-35039 UO1-AI-35040 UO1-A1-37613 and UO1-AI-35041."},{"key":"e_1_3_1_38_2","doi-asserted-by":"publisher","DOI":"10.1056\/NEJM198910263211701"},{"key":"e_1_3_1_38_3","doi-asserted-by":"crossref","first-page":"228","DOI":"10.1093\/infdis\/172.1.228","volume":"172","author":"Lederman M. M.","year":"1995","unstructured":"Lederman M. M., et al., J. Infect. Dis. 172, 228 (1995).","journal-title":"J. Infect. Dis."},{"key":"e_1_3_1_39_2","doi-asserted-by":"publisher","DOI":"10.1097\/00002030-199408000-00014"},{"key":"e_1_3_1_39_3","doi-asserted-by":"publisher","DOI":"10.1126\/science.3163848"},{"key":"e_1_3_1_40_2","unstructured":"Of 2993 typed individuals in five cohorts (33) 445 were high-risk uninfected and 2548 were HIV-1 infected. No significant difference in CCR2 allele or genotype frequency was apparent between high-risk exposed uninfected individuals versus HIV-1\u2013infected patients (alleles: \u03c7 2 = 0.31; P = 0.86; genotypes g = 1.12; P = 0.57). The same lack of difference was observed when individual cohorts were examined."},{"key":"e_1_3_1_41_2","unstructured":"G = 0.44; P = 0.5. Only Caucasian individuals were examined in this analysis. CCR5-\u039432\/\u039432 homozygotes were excluded to remove known protective effects (19-22) because none of these would have CCR2-64I genotypes due to linkage disequilibrium (see text)."},{"key":"e_1_3_1_42_2","unstructured":"Seroconverter patients included 891 subjects with a maximum interval of 3 years between an HIV-1 antibody\u2013negative test date and their first HIV-1 antibody\u2013positive test date. Seroconversion date was the midpoint between the last HIV-1 antibody\u2013negative and first positive clinic visits. Ninety patients enrolled in the SFCC study before 31 December 1980 were included using imputed seroconversion dates based on their date of first HIV-1 antibody positive because the likelihood of infection before 1 January 1978 (a 3-year window of infection) was extremely low (\u22640.01). Seroconversion dates for the imputed SFCC subjects were set at 60 days 120 days and 180 days before the date for first antibody positive visit for patients enrolled in 1978 1979 and 1980 respectively (38)."},{"key":"e_1_3_1_43_2","unstructured":"Proportional Hazard Regression SAS Release 6.10 SAS Institute Cary NC."},{"key":"e_1_3_1_44_2","unstructured":"Centers for Disease Control Morb. Mort. Wkly. Rep. 36 (supplement 1) (14 August 1987); ibid. 41 (18 December 1992). This publication contains a revised classification system for HIV infection and an expanded surveillance case definition for AIDS among adolescents and adults. It went into effect in January 1993."},{"key":"e_1_3_1_45_2","unstructured":"The ALIVE cohort is composed of 94% African Americans and the large racial difference between ALIVE and other cohorts (MACS MHCS SFCC and HGDS are composed of 6% 13% 4% and 10% African Americans respectively) may contribute to the absence of a survival effect of CCR2 genotypes seen in Table 1. Alternatively the results may reflect the relatively shorter period of follow-up because the ALIVE began enrollment in 1988 (33). In support of the latter explanation is the elevated CCR2-+\/64 I \u201cprotective\u201d genotype frequency among ALIVE slow progressors relative to rapid progressors to AIDS for the three AIDS endpoints (Fig. 2). Because this result is not statistically significant the conclusion remains tentative until longer follow-up of African American cohorts becomes available."},{"key":"e_1_3_1_46_2","unstructured":"Because the four cohorts show no significant differences in CCR2 allele or genotype frequency they were pooled to test for significant differences between rapid and slow or nonprogressors which were apparent. In addition CCR2-64I containing genotypes were higher in all cohorts for 24 of 24 comparisons (two genotypes four cohorts three AIDS outcomes). Because these comparisons are interdependent we applied a sign test to eight comparisons (four cohorts two genotypes) to detect P \u2264 0.004."},{"key":"e_1_3_1_47_2","unstructured":"When a conservative sign test to three genotypes and three cohorts was applied for only one outcome there was a significant excess of [ +\/\u039432 ] [ 64I\/+ ] and [ 64I\/64I ] {Fig. 2 and (54) for [ 64I\/64I ]} ( P = 0.002)."},{"key":"e_1_3_1_48_2","unstructured":"M. L. Levin Acta Unio Int. Contra Cancrum 9 531 (1953). Estimates of attributable risk were computed for Caucasians (Fig. 3); they likely vary among ethnic groups particularly because of the differences in CCR5-\u039432 frequencies in Asians and African Americans (18-22)."},{"key":"e_1_3_1_49_2","doi-asserted-by":"crossref","first-page":"3219","DOI":"10.1128\/jvi.71.4.3219-3227.1997","volume":"71","author":"Rana S.","year":"1997","unstructured":"Rana S., et al., J. Virol. 71, 3219 (1997).","journal-title":"J. Virol."},{"key":"e_1_3_1_50_2","unstructured":"J. C. Stephens et al. in preparation."},{"key":"e_1_3_1_51_2","doi-asserted-by":"crossref","first-page":"1925","DOI":"10.1073\/pnas.94.5.1925","volume":"94","author":"Bleul C. C.","year":"1997","unstructured":"Bleul C. C., et al., Proc. Natl. Acad. Sci. U.S.A. 94, 1925 (1997);","journal-title":"Proc. Natl. Acad. Sci. U.S.A."},{"key":"e_1_3_1_51_3","first-page":"640","volume":"26","author":"Qin S.","year":"1996","unstructured":"Qin S., et al., J. Immunol. 26, 640 (1996).","journal-title":"J. Immunol."},{"key":"e_1_3_1_52_2","doi-asserted-by":"crossref","first-page":"437","DOI":"10.1016\/S0092-8674(00)81364-1","volume":"87","author":"Rucker J.","year":"1996","unstructured":"Rucker J., et al., Cell 87, 437 (1996).","journal-title":"Cell"},{"key":"e_1_3_1_53_2","doi-asserted-by":"crossref","first-page":"11703","DOI":"10.1074\/jbc.270.20.11703","volume":"270","author":"Ben-Barauch A.","year":"1995","unstructured":"Ben-Barauch A., Michiel D. F., Oppenheim J. J., J. Biol. Chem. 270, 11703 (1995);","journal-title":"J. Biol. Chem."},{"key":"e_1_3_1_53_3","doi-asserted-by":"crossref","first-page":"46","DOI":"10.1016\/0167-7799(96)80920-6","volume":"14","author":"Howard O. M. Z.","year":"1996","unstructured":"Howard O. M. Z., et al., Trends Biotechnol. 14, 46 (1996);","journal-title":"Trends Biotechnol."},{"key":"e_1_3_1_53_4","unstructured":"; J. M. Wang and J. Oppenheim et al. personal communication."},{"key":"e_1_3_1_54_2","doi-asserted-by":"crossref","first-page":"1681","DOI":"10.1084\/jem.185.9.1681","volume":"185","author":"Wu L.","year":"1997","unstructured":"Wu L., et al., J. Exp. Med. 185, 1681 (1997).","journal-title":"J. Exp. Med."},{"key":"e_1_3_1_55_2","unstructured":"M. W. Smith et al. data not shown."},{"key":"e_1_3_1_56_2","unstructured":"We gratefully acknowledge the patients their families and clinicians who have participated in the ALIVE MACS MHCS HGDS and SFCC cohort studies. We thank R. Boaze R. Byrd S. Cevario B. Gerrard P. Lloyd M. McNally M. Malasky S. Shrestha E. Topper and M. Weedon for technical assistance and S. Edelstein A. Munoz S. Donfield E. Gomperts J. Giorgi and J. Oppenheim for helpful discussions. The Frederick Biomedical Supercomputing Center provided computational resources used in some of our analyses. Additional analyses and data mentioned here can be inspected at"}],"container-title":["Science"],"original-title":[],"language":"en","link":[{"URL":"https:\/\/www.science.org\/doi\/pdf\/10.1126\/science.277.5328.959","content-type":"unspecified","content-version":"vor","intended-application":"similarity-checking"}],"deposited":{"date-parts":[[2024,1,13]],"date-time":"2024-01-13T05:46:50Z","timestamp":1705124810000},"score":1,"resource":{"primary":{"URL":"https:\/\/www.science.org\/doi\/10.1126\/science.277.5328.959"}},"subtitle":[],"short-title":[],"issued":{"date-parts":[[1997,8,15]]},"references-count":75,"journal-issue":{"issue":"5328","published-print":{"date-parts":[[1997,8,15]]}},"alternative-id":["10.1126\/science.277.5328.959"],"URL":"https:\/\/doi.org\/10.1126\/science.277.5328.959","relation":{},"ISSN":["0036-8075","1095-9203"],"issn-type":[{"value":"0036-8075","type":"print"},{"value":"1095-9203","type":"electronic"}],"subject":[],"published":{"date-parts":[[1997,8,15]]}}}