{"status":"ok","message-type":"work","message-version":"1.0.0","message":{"indexed":{"date-parts":[[2026,3,24]],"date-time":"2026-03-24T02:51:12Z","timestamp":1774320672648,"version":"3.50.1"},"reference-count":25,"publisher":"American Association for the Advancement of Science (AAAS)","issue":"5381","content-domain":{"domain":[],"crossmark-restriction":false},"short-container-title":["Science"],"published-print":{"date-parts":[[1998,8,28]]},"abstract":"<jats:p>\n            How an individual effector T cell acquires a particular cytokine expression pattern from many possible patterns remains unclear. CD4\n            <jats:sup>+<\/jats:sup>\n            T cells from F\n            <jats:sub>1<\/jats:sub>\n            mice, which allowed assignment of the parental origin of interleukin-4 (IL-4) transcripts, were divided into clones that expressed IL-4 biallelically or monoallelically from either allele. The allelic pattern was transmitted as a stable epigenetic trait. Regulation of cytokine expression by a mechanism that treats each allele independently suggests a probabilistic process by which a diverse repertoire of combinatorially assorted cytokine gene expression patterns could be generated among the clonally related daughters of a single precursor cell.\n          <\/jats:p>","DOI":"10.1126\/science.281.5381.1352","type":"journal-article","created":{"date-parts":[[2002,7,27]],"date-time":"2002-07-27T09:43:20Z","timestamp":1027763000000},"page":"1352-1354","source":"Crossref","is-referenced-by-count":189,"title":["Independent and Epigenetic Regulation of the Interleukin-4 Alleles in CD4\n            <sup>+<\/sup>\n            T Cells"],"prefix":"10.1126","volume":"281","author":[{"given":"Mark","family":"Bix","sequence":"first","affiliation":[{"name":"Howard Hughes Medical Institute and Departments of Medicine and Microbiology\/Immunology, University of California, San Francisco (UCSF), San Francisco, CA 94143\u20130654, USA."}]},{"given":"Richard M.","family":"Locksley","sequence":"additional","affiliation":[{"name":"Howard Hughes Medical Institute and Departments of Medicine and Microbiology\/Immunology, University of California, San Francisco (UCSF), San Francisco, CA 94143\u20130654, USA."}]}],"member":"221","reference":[{"key":"e_1_3_1_2_2","doi-asserted-by":"publisher","DOI":"10.1038\/383787a0"},{"key":"e_1_3_1_3_2","doi-asserted-by":"crossref","first-page":"9189","DOI":"10.1073\/pnas.85.23.9189","volume":"85","author":"Kelso A.","year":"1988","unstructured":"Kelso A., Gough N. M., Proc. Natl. Acad. Sci. U.S.A. 85, 9189 (1988);","journal-title":"Proc. Natl. Acad. Sci. U.S.A."},{"key":"e_1_3_1_3_3","doi-asserted-by":"crossref","first-page":"1251","DOI":"10.1084\/jem.180.4.1251","volume":"180","author":"Bucy R. P.","year":"1994","unstructured":"Bucy R. P., et al., J. Exp. Med. 180, 1251 (1994);","journal-title":"J. Exp. Med."},{"key":"e_1_3_1_3_4","doi-asserted-by":"crossref","first-page":"1097","DOI":"10.1002\/eji.1830240513","volume":"24","author":"Assenmacher M.","year":"1994","unstructured":"Assenmacher M., Schmitz J., Radbruch A., Eur. J. Immunol. 24, 1097 (1994);","journal-title":"Eur. J. Immunol."},{"key":"e_1_3_1_3_5","first-page":"1168","volume":"25","author":"Kelso A.","year":"1995","unstructured":"Kelso A., Groves P., Troutt A. B., Francis K., ibid. 25, 1168 (1995).","journal-title":"ibid."},{"key":"e_1_3_1_4_2","doi-asserted-by":"crossref","first-page":"7565","DOI":"10.1073\/pnas.92.16.7565","volume":"92","author":"Bucy R. P.","year":"1995","unstructured":"Bucy R. P., et al., Proc. Natl. Acad. Sci. U.S.A. 92, 7565 (1995).","journal-title":"Proc. Natl. Acad. Sci. U.S.A."},{"key":"e_1_3_1_5_2","unstructured":"Cellular RNA was isolated through use of RNAzol-B (Biotecx Houston TX). cDNA was prepared with a kit from Clontech Laboratories (Palo Alto CA). PCR primers spanned the first intron of the IL-4 gene to avoid contributions by DNA contamination. PCR was done with a primer from exon 1 (ACTTAATTGTCTCTCGTCACT) together with a primer from exon 2 (ACGTTTGGCACATCCATCTCC) or a nested primer that spanned the exon 1\u2013exon 2 splice junction (CATGGCGTCCCTTCTCCTGT). The first-round PCR reaction (one cycle: 94\u00b0C for 2 min 56\u00b0C for 4 min 72\u00b0C for 2 min; 38 cycles: 94\u00b0C for 1 min 56\u00b0C for 1 min 72\u00b0C for 2 min) with exon 1 and exon 2 primers yielded a 203\u2013base pair (bp) product. The second-round reaction (one cycle: 94\u00b0C for 2 min; 30 cycles: 94\u00b0C for 1 min 56\u00b0C for 1 min 72\u00b0C for 2 min) with exon 1 and the nested primer yielded a product 26 bp smaller. Sequence analysis of the IL-4 gene revealed a polymorphism in exon 1 that allowed discrimination of 129 and BALB\/c from CAST\/Ei strain cDNA by differential sensitivity to Bsg I endonuclease. CAST\/Ei PCR products were sensitive to Bsg I liberating two restriction fragments of 9 and 194 bp (and for nested reactions 9 and 168 bp). PCR products from all strains were sensitive to Sau 3AI liberating two restriction fragments of 134 and 69 bp (for nested reactions 134 and 43 bp). Restriction fragments were resolved through 3.5% Metaphor agarose (FMC BioProducts Rockland ME) in 1\u00d7 tris-borate\u2013EDTA buffer."},{"key":"e_1_3_1_6_2","unstructured":"CD4 + T cells enriched from the lymph nodes and spleen of (129 \u00d7 CAST\/Ei)F 1 hybrid mice were stimulated with soluble mAbs to TCR\u03b2 (H57 20 \u03bcg\/ml) and CD28 (37.51 5 \u03bcg\/ml) together with irradiated T cell\u2013depleted BALB\/c spleen cells recombinant murine IL-4 (10 ng\/ml) recombinant human IL-2 (50 U\/ml) and IL-12 mAb (C17.15 100 \u03bcg\/ml). Three days later F 1 T cells were recovered by purification over Ficoll."},{"key":"e_1_3_1_7_2","unstructured":"Stimulated F 1 cells were distributed in five serial 10-fold dilutions in which the total cell number of each dilution was normalized by the addition of thymocytes from IL-4 gene-knockout mice (18). IL-4 null thymocytes did not generate a signal in these assays and thus served to normalize the conditions. From each dilution 100 samples each containing 1000 cells were frozen for later analysis. Ten aliquots from each of the five dilutions were then sampled for the presence of IL-4 mRNA. RNA isolated from each aliquot was used to make cDNA from which a sensitive semi-nested IL-4 PCR reaction was performed (Fig. 1A). A dilution that yielded a frequency of one positive IL-4 PCR signal out of 10 sampled aliquots was chosen for further analysis because positive aliquots from such a dilution were unlikely to result from the RNA of two or more distinct IL-4\u2013producing cells. Calculation of the estimated numbers of IL-4\u2013expressing cells in the starting population yielded a frequency of 3.6% in agreement with previous studies (3). The remaining 90 aliquots from each positive dilution were then processed into cDNA and analyzed for IL-4 expression by semi-nested PCR followed by Bsg I digestion to discern the parental source of the transcripts and as a control with Sau 3AI which recognizes the products of both alleles."},{"key":"e_1_3_1_8_2","doi-asserted-by":"publisher","DOI":"10.1016\/S0092-8674(94)90562-2"},{"key":"e_1_3_1_9_2","first-page":"1217","volume":"10","author":"Melo J. V.","year":"1996","unstructured":"Melo J. V., Yan X. H., Diamond J., Lin F., Cross N. C., Goldman J. M., Leukemia 10, 1217 (1996).","journal-title":"Leukemia"},{"key":"e_1_3_1_10_2","unstructured":"M. Bix and R. Locksley; unpublished data."},{"key":"e_1_3_1_11_2","unstructured":"A panel of 30 alloreactive (anti-H2 b ) CD4 + T H 2 clones were generated from (BALB\/c \u00d7 CAST\/Ei)F 1 mice in three separate experiments designated A B and C yielding 4 3 and 23 clones respectively. Series A clones were derived from a single F 1 mouse immunized intraperitoneally 1 month earlier with 50 \u00d7 10 6 female C57BL\/6 \u03b2 2 -microglobulin (\u03b2 2 M)\u2013deficient (\u03b2 2 M \u2212\/\u2212 ) spleen cells whereas B and C clones were derived from the same pool of two unimmunized F 1 mice. The \u03b2 2 M \u2212\/\u2212 mice which do not express major histocompatibility complex class I molecules (19) were used to avoid the outgrowth of CD8 + alloreactive T cell clones. Clones were generated in cultures with irradiated C57BL\/6 \u03b2 2 M \u2212\/\u2212 spleen cells IL-4 IL-2 and anti\u2013IL-12 (all at the above concentrations). Two days after the second in vitro culture CD4 + L-selectin lo H2-A d+ cells were distributed by flow cytometry (Becton Dickinson Vantage Mountain View CA) as single cells (series A or B) or by limiting dilution (series C) into 96-well plates containing irradiated T cell\u2013depleted C57BL\/6 spleen cells IL-4 and IL-2. Clones were picked 16 to 37 days after plating. Cloning efficiency ranged from 0.4 to 3%."},{"key":"e_1_3_1_12_2","unstructured":"Clones containing 10 4 to 10 5 cells were activated for 17 hours by culture on plates coated with mAbs to TCR\u03b2 (H57-597 10 \u03bcg\/ml) and CD28 (37N51.1 10 \u03bcg\/ml) before harvesting for RNA."},{"key":"e_1_3_1_13_2","unstructured":"DNA was prepared from clones by standard methods and used to template primers that distinguish sequence length polymorphisms between BALB\/c and CAST\/Ei at positions D11Mit20 D11Mit271 and D11Mit242 flanking the IL-4 gene on chromosome 11."},{"key":"e_1_3_1_14_2","doi-asserted-by":"crossref","first-page":"2067","DOI":"10.1126\/science.279.5359.2067","volume":"279","author":"Chess A.","year":"1998","unstructured":"Chess A., Science 279, 2067 (1998).","journal-title":"Science"},{"key":"e_1_3_1_15_2","doi-asserted-by":"crossref","first-page":"355","DOI":"10.1038\/376355a0","volume":"376","author":"Held W.","year":"1995","unstructured":"Held W., Roland J., Raulet D. H., Nature 376, 355 (1995).","journal-title":"Nature"},{"key":"e_1_3_1_16_2","doi-asserted-by":"publisher","DOI":"10.1126\/science.279.5359.2118"},{"key":"e_1_3_1_17_2","doi-asserted-by":"crossref","first-page":"2876","DOI":"10.1002\/eji.1830271120","volume":"27","author":"Held W.","year":"1997","unstructured":"Held W., Raulet D. H., Eur. J. Immunol. 27, 2876 (1997).","journal-title":"Eur. J. Immunol."},{"key":"e_1_3_1_18_2","doi-asserted-by":"crossref","first-page":"59","DOI":"10.1016\/0092-8674(95)90234-1","volume":"83","author":"Wu H.","year":"1995","unstructured":"Wu H., Liu X., Jaenisch R., Lodish H. F., Cell 83, 59 (1995);","journal-title":"Cell"},{"key":"e_1_3_1_18_3","doi-asserted-by":"crossref","first-page":"609","DOI":"10.1016\/S0959-437X(97)80007-X","volume":"7","author":"Cross M. A.","year":"1997","unstructured":"Cross M. A., Enver T., Curr. Opin. Genet. Dev. 7, 609 (1997);","journal-title":"Curr. Opin. Genet. Dev."},{"key":"e_1_3_1_18_4","unstructured":"; D. Kioussis and R. Festenstein in Molecular Biology of B-Cell and T-Cell Development J. G. Monroe and E. V. Rothenberg Eds. (Humana Totowa NJ 1998) pp. 31\u201350."},{"key":"e_1_3_1_19_2","doi-asserted-by":"publisher","DOI":"10.1126\/science.1948049"},{"key":"e_1_3_1_20_2","doi-asserted-by":"crossref","first-page":"742","DOI":"10.1038\/344742a0","volume":"344","author":"Zijlstra M.","year":"1990","unstructured":"Zijlstra M., et al., Nature 344, 742 (1990).","journal-title":"Nature"},{"key":"e_1_3_1_21_2","unstructured":"We thank J. Sundberg and D. Boggess for CAST\/Ei parental and F 1 mice; R. Coffman G. Trinchieri and J. Allison for reagents; E. Weider for assistance with flow cytometry; and D. Raulet and N. Killeen for critical reading of the manuscript. Animals were cared for in accordance with institutional guidelines. Supported by NIH grants AI26918 and HL56385 Irvington Institute and Burroughs Wellcome."}],"container-title":["Science"],"original-title":[],"language":"en","link":[{"URL":"https:\/\/www.science.org\/doi\/pdf\/10.1126\/science.281.5381.1352","content-type":"unspecified","content-version":"vor","intended-application":"similarity-checking"}],"deposited":{"date-parts":[[2024,1,13]],"date-time":"2024-01-13T03:15:37Z","timestamp":1705115737000},"score":1,"resource":{"primary":{"URL":"https:\/\/www.science.org\/doi\/10.1126\/science.281.5381.1352"}},"subtitle":[],"short-title":[],"issued":{"date-parts":[[1998,8,28]]},"references-count":25,"journal-issue":{"issue":"5381","published-print":{"date-parts":[[1998,8,28]]}},"alternative-id":["10.1126\/science.281.5381.1352"],"URL":"https:\/\/doi.org\/10.1126\/science.281.5381.1352","relation":{},"ISSN":["0036-8075","1095-9203"],"issn-type":[{"value":"0036-8075","type":"print"},{"value":"1095-9203","type":"electronic"}],"subject":[],"published":{"date-parts":[[1998,8,28]]}}}